View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4586_low_61 (Length: 210)
Name: NF4586_low_61
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4586_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 8 - 192
Target Start/End: Complemental strand, 19568907 - 19568722
Alignment:
| Q |
8 |
gagcagagaacaaatactatacaaataatagnnnnnnnnn-ggtacaagaacaaataatagtattactattgaaaattctttaatatgcttaaatttcaa |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19568907 |
gagccgagaacaaatactatacaaataatagttttttttttggtacaagaacaaataatagtattactattgaaaattctttaatatgcttaaatttcaa |
19568808 |
T |
 |
| Q |
107 |
taaataacaatatttatcaagtccattgtcctgttatataaaatttaatattccaaatgctctattgtaaagctagttaatttagt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19568807 |
taaataacaatatttatcaagtccattgtcctgttatataaaatttaatattccaaatgctctattgtaaagctagttaatttagt |
19568722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University