View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4586_low_62 (Length: 208)
Name: NF4586_low_62
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4586_low_62 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 152 - 190
Target Start/End: Original strand, 8521930 - 8521968
Alignment:
| Q |
152 |
ctaactaatcatgtaaatatcacacttaccatgtctatt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8521930 |
ctaactaatcatgtaaatatcacacttatcatgtctatt |
8521968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 8521838 - 8521875
Alignment:
| Q |
1 |
taaaattgtaaaatttcttgtaaaatgggtaaatgatc |
38 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8521838 |
taaaattgtaaaatttcttgtaaaatctgtaaatgatc |
8521875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University