View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4586_low_62 (Length: 208)

Name: NF4586_low_62
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4586_low_62
NF4586_low_62
[»] chr3 (2 HSPs)
chr3 (152-190)||(8521930-8521968)
chr3 (1-38)||(8521838-8521875)


Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 152 - 190
Target Start/End: Original strand, 8521930 - 8521968
Alignment:
152 ctaactaatcatgtaaatatcacacttaccatgtctatt 190  Q
    |||||||||||||||||||||||||||| ||||||||||    
8521930 ctaactaatcatgtaaatatcacacttatcatgtctatt 8521968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 8521838 - 8521875
Alignment:
1 taaaattgtaaaatttcttgtaaaatgggtaaatgatc 38  Q
    ||||||||||||||||||||||||||  ||||||||||    
8521838 taaaattgtaaaatttcttgtaaaatctgtaaatgatc 8521875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University