View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4587_low_7 (Length: 246)
Name: NF4587_low_7
Description: NF4587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4587_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 4 - 102
Target Start/End: Original strand, 49040681 - 49040779
Alignment:
| Q |
4 |
gataaccttcaatttcattactatatgctgaatagtatccgagtgtcaaatttatcccgaaaacacaaactaatacaagttatatatgtattagctata |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040681 |
gataaccttcaatttcattactatatgctgaatagtatccgagtgtcaaatttatcatgaaatcacaaactaatacaagttatatatgtattagctata |
49040779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 49040779 - 49040849
Alignment:
| Q |
139 |
aatttttatgatatagcaaatcctttgttatatctcaacaagatagtcgaagaacataaagtatatttctt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49040779 |
aatttttatgatatagcaaatcctttgttatatctcaacaagatagttgaagaacataaagtatatttctt |
49040849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University