View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4588-Insertion-1 (Length: 786)
Name: NF4588-Insertion-1
Description: NF4588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4588-Insertion-1 |
 | |
|
| [»] scaffold0031 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 496 - 729
Target Start/End: Complemental strand, 15329041 - 15328811
Alignment:
| Q |
496 |
gaaggatgcaaaagtattaagaaaaagtcttaatagctaaggttagaactaattaaaagttaaaacatggcattgtgactattcaatagctaccttgcca |
595 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15329041 |
gaaggaagcaaaagtattaagaaagagtcttaatagctaaggttagaactaataaaaagttaaaacatggcattgtgactattcaatagctaccttgcca |
15328942 |
T |
|
| Q |
596 |
attcaaattgggaatggttatttaggttccctacgacctaaaaatactgatttaaagtggtatgctgctaagttttagcagcagactttgagcataactc |
695 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15328941 |
attcaaattggaaatggttatttaggttccctacgacctcaaaatactgatttaaagtggta---tgctaagttttagcagcagactttgagcataactc |
15328845 |
T |
|
| Q |
696 |
aaagtgacactacctaggactcatgtaccaaaac |
729 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |
|
|
| T |
15328844 |
aaagtgacactacgtaggattcatgtaccaaaac |
15328811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 390 - 449
Target Start/End: Complemental strand, 15329119 - 15329060
Alignment:
| Q |
390 |
ctttctgcataattatgcagaaaaatgtgtgatcaagtttgttattagcttaggcacatg |
449 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15329119 |
ctttctgcataattatgtagaaaaatgtgtgatcaagtttgttattagcttagtcacatg |
15329060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 1e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 335 - 448
Target Start/End: Original strand, 12655159 - 12655271
Alignment:
| Q |
335 |
ggaatcaaatgaaggtgatcattaggcttatctacggatttcgggtacctcttgactttctgcataattatgcagaaaaatgtgtgatcaagtttgttat |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | | || |||| ||||| ||| ||||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
12655159 |
ggaatcaaatgaaggtgatcattaggcttatctaagaactttcagtacg-cttgattttttgcatcattatgcagaaaaatgtgttaacaagtttgttat |
12655257 |
T |
|
| Q |
435 |
tagcttaggcacat |
448 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
12655258 |
tagctcaggcacat |
12655271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 391 - 447
Target Start/End: Complemental strand, 12418778 - 12418720
Alignment:
| Q |
391 |
tttctgcataattatgcagaaaaat--gtgtgatcaagtttgttattagcttaggcaca |
447 |
Q |
| |
|
|||||||||||||||| ||||| || |||||| |||||| |||||||||||||||||| |
|
|
| T |
12418778 |
tttctgcataattatgaagaaatatttgtgtgaacaagttcgttattagcttaggcaca |
12418720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 337 - 420
Target Start/End: Complemental strand, 80267 - 80184
Alignment:
| Q |
337 |
aatcaaatgaaggtgatcattaggcttatctacggatttcgggtacctcttgactttctgcataattatgcagaaaaatgtgtg |
420 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||| || ||||||||| | ||||||||||||||||||||||||| |||| |
|
|
| T |
80267 |
aatcaaatgaaggtgatcatttggattatctaaggacttttggtacctctgaattttctgcataattatgcagaaaaatatgtg |
80184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University