View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4588-Insertion-3 (Length: 543)
Name: NF4588-Insertion-3
Description: NF4588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4588-Insertion-3 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 483; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 483; E-Value: 0
Query Start/End: Original strand, 9 - 543
Target Start/End: Complemental strand, 34946477 - 34945943
Alignment:
| Q |
9 |
tttctaatctaaattgtttttatcttgtgatattattgcaattaattgatttattagttgtttacttgtttaatactgtttttgtttttcagcttgatat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34946477 |
tttctaatctaaattgtttttatcttgtgatattattgcaattaattgatttattagttgtttacttgtttaattctgtttttgtttttcagcttgatat |
34946378 |
T |
|
| Q |
109 |
ttttgagcttattggtgtgcctctagtagagaattgtttggctgggttcaatagttctgtttttgcttatgggcaggtttctatctaatttcatctcagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
34946377 |
ttttgagcttattggtgtgcctctagtagagaattgtttggctgggttcaatagttctgtttttgcttatgggcaggtttctttctaatttcatctccgt |
34946278 |
T |
|
| Q |
209 |
gattttgcttttgttactattcttgattattatgaattttcaannnnnnnnnnnncaatgcagaccgggagtggaaagacctacactatgtggggtcctc |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34946277 |
gattttgcttttgttactattcttgattattatgaattttcaatttttgttttttcaatgcagaccgggagtggaaagacctacactatgtggggtcctc |
34946178 |
T |
|
| Q |
309 |
ccaatgctttggcggttgaaaattcatcaattgatcaacaaggaggtctcgcccctcgtgtttttgagcgactctttgcacgcataactgaagttagtat |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34946177 |
ccaatgctttggcggttgaaaattcatcaattgatcaacaaggaggtctcgcccctcgtgtttttgagcgactctttgcacgcataactgaagttagtat |
34946078 |
T |
|
| Q |
409 |
caattttaagttttattccttgttgaatcctttgaccactctacgaaccttgctgttatatcaattaatcgttgtgtctcatgtgtaggagcaaactaag |
508 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34946077 |
caattttaagttttattccttgttgaatcctttgaccactctacgaaccttgctgttatatcaattaatagttgtgtctcatgtgtaggagcaaactaag |
34945978 |
T |
|
| Q |
509 |
cactccgacaagcaactcaagtatcaatgtcactg |
543 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34945977 |
cactccgacaagcaactcaagtatcaatgtcactg |
34945943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 91 - 188
Target Start/End: Original strand, 38289715 - 38289812
Alignment:
| Q |
91 |
tgtttttcagcttgatatttttgagcttattggtgtgcctctagtagagaattgtttggctgggttcaatagttctgtttttgcttatgggcaggttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||| | | || || ||| | || ||||||||||||||||| ||||||||||| || ||||| ||||| ||||||| |
|
|
| T |
38289715 |
tgtttttcagcttgatatttttgagcatgtcggggttcctttggtcgagaattgtttggctggtttcaatagttcagtatttgcatatggacaggttt |
38289812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University