View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4588-Insertion-6 (Length: 188)
Name: NF4588-Insertion-6
Description: NF4588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4588-Insertion-6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 9e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 9e-75
Query Start/End: Original strand, 11 - 187
Target Start/End: Original strand, 2320179 - 2320356
Alignment:
| Q |
11 |
ctcactcccatcgc-aagactgtaggggagctccgccgtaacactgccctttttgaccaattcctcatactaaagtctttcagctagctacaattgcccc |
109 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
2320179 |
ctcactcccaccgccaagagtgtaggggagctccaccgtaacactgccctttttgaccaattcctcatactaaagtctttcagctagccgcaattgtccc |
2320278 |
T |
 |
| Q |
110 |
tgatttcgatcccacaatgtcttcttcctctgattcagtctcatcttctgactccatttgaaatcttgacatgctcag |
187 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2320279 |
tgatttcgaccccacaatgtcttcttcctctgattcagtctcatcttctgactccatttgaaatcttgacatgctcag |
2320356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University