View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4588-Insertion-8 (Length: 131)
Name: NF4588-Insertion-8
Description: NF4588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4588-Insertion-8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 3e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 3e-64
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 27136091 - 27135968
Alignment:
| Q |
8 |
caaagaggtccttcagcaatagcaaaaccatccccaaacaaaaactcagaaacctcagcaacaagacctttaccatatttaccataattcttaagaacat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27136091 |
caaagaggtccttcagcaatagcaaaaccatccccaaacaaaaactcagaaacctcagcaacaagacctttaccatatttaccataattcttaagaacat |
27135992 |
T |
 |
| Q |
108 |
gtttagcaatagcaggatcactaa |
131 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27135991 |
gtttagcaatagcaggatcactaa |
27135968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University