View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4588_high_13 (Length: 242)
Name: NF4588_high_13
Description: NF4588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4588_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 38999917 - 38999786
Alignment:
| Q |
1 |
tacatgttaatctagtagtatacataatggattgatcgaacatcatgttatcattcattctactaggtgagaatactctttacatgttcttaagtccttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
38999917 |
tacatgttaatctagtagtatacataatggattgatcgaacatcatgttatcattcattctactaggtgagaatactcttttcatgttctttagtccttt |
38999818 |
T |
 |
| Q |
101 |
acatattttctctctttccattgatttgtagc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38999817 |
acatattttctctctttccattgatttgtagc |
38999786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 226
Target Start/End: Complemental strand, 38999625 - 38999597
Alignment:
| Q |
198 |
gtgtcccaaagggtgcaggaattggataa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38999625 |
gtgtcccaaagggtgcaggaattggataa |
38999597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University