View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4588_low_13 (Length: 248)
Name: NF4588_low_13
Description: NF4588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4588_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 22 - 239
Target Start/End: Original strand, 46737046 - 46737263
Alignment:
| Q |
22 |
acaggggatgttgttgctcatagaaaaccatgtatggatcatgatcacattccatattaatgaaggcatctgcactaccattagtttcacggtacacatg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
46737046 |
acaggggatgttgttgctcatagaaaaccatgtatggatcatgatcgcattccatattaatgaaggcatctgcacaaccattagcttcacggtacacatg |
46737145 |
T |
 |
| Q |
122 |
acacactctaacttcacaatctgtttgaagtatccgacgaatatgttgcactagcctccaccaatctgtcaacactgtattaggatcaagaatattttca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46737146 |
acacactctaacttcacaatctgtttgaagtatccgacgaatatgttgcactagcctccaccaatctgtctacactgtattaggatcaagaatattttca |
46737245 |
T |
 |
| Q |
222 |
gctaccacctttgcttct |
239 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46737246 |
gctaccacctttgcttct |
46737263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University