View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4588_low_14 (Length: 242)

Name: NF4588_low_14
Description: NF4588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4588_low_14
NF4588_low_14
[»] chr5 (2 HSPs)
chr5 (1-132)||(38999786-38999917)
chr5 (198-226)||(38999597-38999625)


Alignment Details
Target: chr5 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 38999917 - 38999786
Alignment:
1 tacatgttaatctagtagtatacataatggattgatcgaacatcatgttatcattcattctactaggtgagaatactctttacatgttcttaagtccttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||    
38999917 tacatgttaatctagtagtatacataatggattgatcgaacatcatgttatcattcattctactaggtgagaatactcttttcatgttctttagtccttt 38999818  T
101 acatattttctctctttccattgatttgtagc 132  Q
    ||||||||||||||||||||||||||||||||    
38999817 acatattttctctctttccattgatttgtagc 38999786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 198 - 226
Target Start/End: Complemental strand, 38999625 - 38999597
Alignment:
198 gtgtcccaaagggtgcaggaattggataa 226  Q
    |||||||||||||||||||||||||||||    
38999625 gtgtcccaaagggtgcaggaattggataa 38999597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University