View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4589_high_4 (Length: 474)
Name: NF4589_high_4
Description: NF4589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4589_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 50 - 298
Target Start/End: Complemental strand, 43813790 - 43813542
Alignment:
| Q |
50 |
tcctttgattcttcaactgaggcatcaacaccgttgagtcatgctactttgtaattggctaggcgtgcatgtctgtcttccctggtctttaggtatctat |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43813790 |
tcctttgattcttcaactgaggcatcaacaccgttgagtcatgctactttgtaattggctaggcgtgcatgtctgtcttccctggtctttaggtatctat |
43813691 |
T |
 |
| Q |
150 |
atttgacctttaattacaacctcaacttaagcaaattttcaactaacataataattnnnnnnntaattcaaattttgtttctctcactcttaaacccatc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43813690 |
atttgacctttaattacaacctcaacttaagcaaattttcaactaacataataattaaaaaaataattcaaattttgtttctctcactcttaaacccatc |
43813591 |
T |
 |
| Q |
250 |
ccactaattacttatacaacatgcaccccacgttcacacaaccatgctc |
298 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43813590 |
ccactaatttcttatacaacatgcaccccacgttcacacaaccatgctc |
43813542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 373 - 469
Target Start/End: Complemental strand, 43813467 - 43813371
Alignment:
| Q |
373 |
gctacaatttcatttcttactatactttggctttctcacctgcattattcctttctctcccactttctctcccattgagggtctcttacaccctatg |
469 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43813467 |
gctacaatttcatttcttactatactttggctttctcacctgcattattcctttctctcccactttctctcccattgagggtctcttacaccctatg |
43813371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University