View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4589_low_15 (Length: 223)
Name: NF4589_low_15
Description: NF4589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4589_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 20 - 133
Target Start/End: Original strand, 43213732 - 43213845
Alignment:
| Q |
20 |
agcatacatgaaggacaattttgcagctcacttcctagctnnnnnnngctacagtttgttctggattatcatcctcttagccttgatcgttctattgctt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43213732 |
agcatacatgaaggacaattttgcagctcacttcctagccaaaaaaagctacagtttgtgctggattatcatcctcttagccttgatcgttctattgctt |
43213831 |
T |
 |
| Q |
120 |
tgaaccttccttga |
133 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43213832 |
tgaaccttccttga |
43213845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 166 - 208
Target Start/End: Original strand, 43213893 - 43213935
Alignment:
| Q |
166 |
gaggttctcattgccacctacttccaacaacccctttgagaat |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43213893 |
gaggttgtcattgccacctacttccaacaacccctttgagaat |
43213935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University