View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4589_low_7 (Length: 365)
Name: NF4589_low_7
Description: NF4589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4589_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 135 - 349
Target Start/End: Original strand, 887825 - 888049
Alignment:
| Q |
135 |
agtatgtgtgaaagaaaaacaattgcaccgccgagatcgatttcataagatgcatgcagaaatgtt------atgtggagatgagaagacaaccataaat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
887825 |
agtatgtgtgaaagaaaaacaattgcaccgcggagatcgatttcataagatgcatgcagaaatgttattgttatgtggagatgagaagataaccataaat |
887924 |
T |
 |
| Q |
229 |
aaagtttgcatcatcttcaagtttcaaaaattagtataattcagttttacgattaaaataggtcatacaactactccctcttt----ttataaatctttt |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
887925 |
aaagtttgcatcatcttcaagtttcaaaaattagtataattcagttttacgattaaaataggtcatacaactactccctctttttaattataaatctttt |
888024 |
T |
 |
| Q |
325 |
ttaaaaaataaaatagtggtatttc |
349 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
888025 |
taaaaaaataaaatagtggtatttc |
888049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 41 - 80
Target Start/End: Original strand, 887728 - 887767
Alignment:
| Q |
41 |
atatcatcctcttgacatgaggagatatgaggtttcatcg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
887728 |
atatcatcctcttgacatgaggagatatgaggtttcatcg |
887767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University