View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4590-Insertion-5 (Length: 151)
Name: NF4590-Insertion-5
Description: NF4590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4590-Insertion-5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 6e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 6e-63
Query Start/End: Original strand, 8 - 133
Target Start/End: Original strand, 40014493 - 40014618
Alignment:
| Q |
8 |
tcttggtcactaccttaaacttctttgtttgaacattgtcctcacaaacttcatggtccatgcacgttacgaggggactacatagactatactacacttc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40014493 |
tcttggtcactaccttaaacttctttgtttgaacattgtcctcacaaacttcatggtccatgcacgttacgaggggactacatggactatactacacttc |
40014592 |
T |
 |
| Q |
108 |
acatgatgatgagagtgtgacatttt |
133 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40014593 |
acatgatgatgagagtgtgacatttt |
40014618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University