View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4590-Insertion-6 (Length: 138)
Name: NF4590-Insertion-6
Description: NF4590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4590-Insertion-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 3e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 8 - 138
Target Start/End: Original strand, 55940494 - 55940624
Alignment:
| Q |
8 |
actacaaggctcagtgaatccaaattgtctttttctgtatgtcagtttatgtatgaaatgaactcacaaagtcaaatcaaccttaaccattttacatttg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
55940494 |
actacaaggctcagtgaatccaaattgtctttttctgtatgtcagtttgtgtatgaaatgaactcacaaagtctaatcaaccttaaccatttcacatttg |
55940593 |
T |
|
| Q |
108 |
cttaataacctatagagtagtcctttcttta |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
55940594 |
cttaataacctatagagtagtcctttcttta |
55940624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University