View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4590-Insertion-7 (Length: 56)
Name: NF4590-Insertion-7
Description: NF4590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4590-Insertion-7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.000000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 11 - 55
Target Start/End: Original strand, 36157579 - 36157623
Alignment:
| Q |
11 |
attacttcagaataacagtattgcatttctcctacttcttttaca |
55 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36157579 |
attacttcagaataatagtattgcatttctcctacttcttttaca |
36157623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University