View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4590_high_13 (Length: 237)
Name: NF4590_high_13
Description: NF4590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4590_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 53955615 - 53955831
Alignment:
| Q |
18 |
aaaacggtgtataaactcttaaaattttggtgtctataactcagctgatttaatgcatgatctccaagcaactgggcaaatttaattggaatgagaattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53955615 |
aaaacggtgtataaactcttaaaattttggtgtctataactcagctgatttaatgcatgatctccaagcaactgggcaaatttaattggaatgagaattg |
53955714 |
T |
|
| Q |
118 |
tcacttataatataaccaactactttgtccatatcaatagtcaatgtgatctccaacgtgaacaa-nnnnnnnnnnnncttacttgaaaggtagatcact |
216 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53955715 |
tcacttaaaatataacc-actactttgtccatatcaatagtcaatgtgatctccaacgtgaacaatttttttttttttcttacttgaaaggtagatcact |
53955813 |
T |
|
| Q |
217 |
gattgttcaaatttaata |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
53955814 |
gattgttcaaatttaata |
53955831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University