View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4590_high_17 (Length: 221)
Name: NF4590_high_17
Description: NF4590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4590_high_17 |
 |  |
|
| [»] chr7 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 21132768 - 21132558
Alignment:
| Q |
7 |
gtttcttcaaagggaactttctctgctggattctatcaggttggcaataacagcttttcattcgccatatggttcacagagatgcagaatcaaactccca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21132768 |
gtttcttcaaagggaactttctctgctggattctatcaggttggcaataacagcttttcattcgccatatggttcacagagatgcagaatcaaactccca |
21132669 |
T |
 |
| Q |
107 |
accccgccaatattgtttggatggcaaaccgtgaaaaacctgtgaatggtacgtaatgttaaaattcatgcaaattatacaatatttatatgccgtattg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21132668 |
accccgccaatattgtttggatggcaaaccgtgaacaacctgtgaatg----gtaatgttaaaattcatgcaaattatacaatatttatatgccgtcttg |
21132573 |
T |
 |
| Q |
207 |
catagagaaatgata |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21132572 |
catagagaaatgata |
21132558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 10 - 182
Target Start/End: Complemental strand, 18661874 - 18661702
Alignment:
| Q |
10 |
tcttcaaagggaactttctctgctggattctatcaggttggcaataacagcttttcattcgccatatggttcacagagatgcagaatcaaactcccaacc |
109 |
Q |
| |
|
||||||||||| || ||||||||||| |||||||| ||||| | ||| |||||||||||||||||||||||||| ||| |||||||| |||| ||| |
|
|
| T |
18661874 |
tcttcaaagggtacattctctgctggcttctatcaaattggcgacaacgcattttcattcgccatatggttcacagaaatgacgaatcaaagtcccgacc |
18661775 |
T |
 |
| Q |
110 |
ccgccaatattgtttggatggcaaaccgtgaaaaacctgtgaatggtacgtaatgttaaaattcatgcaaatt |
182 |
Q |
| |
|
| |||||||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
18661774 |
cagccaatattgtttggatggcaaaccgtgaacaacctgtaaacggtacgtaatgttaaaattcatgcaaatt |
18661702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 21127443 - 21127275
Alignment:
| Q |
7 |
gtttcttcaaagggaactttctctgctggattctatcaggttggcaataacagcttttcattcgccatatggttcacagagatgcagaatcaaactccca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| | || | |||||| ||||| |||||||| | |||||||||||||| || | |
|
|
| T |
21127443 |
gtttcttcaaagggaactttctctgctggattctatcaagttggtgaaaataccttttccttcgcaatatggttttcggagatgcagaatcacggtcgcg |
21127344 |
T |
 |
| Q |
107 |
accccgccaatattgtttggatggcaaaccgtgaaaaacctgtgaatggtacgtaatgttaaaattcat |
175 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||| | ||| |||||||||||||||| |
|
|
| T |
21127343 |
acccagccaatattgtttggatggcaaaccgtgaacaacctgtgaacgatacataatgttaaaattcat |
21127275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 61 - 191
Target Start/End: Complemental strand, 21120005 - 21119879
Alignment:
| Q |
61 |
ttttcattcgccatatggttcacagagatgcagaatcaaactcccaaccccgccaatattgtttggatggcaaaccgtgaaaaacctgtgaatggtacgt |
160 |
Q |
| |
|
||||| ||||||||||||||||| ||| |||||||||||| || |||||||| |||||||||||||||||||||||||||| |||| ||||||| || |
|
|
| T |
21120005 |
ttttccttcgccatatggttcaccgagctgcagaatcaaagtcacaaccccgtcaatattgtttggatggcaaaccgtgaacaaccggtgaatg----gt |
21119910 |
T |
 |
| Q |
161 |
aatgttaaaattcatgcaaattatacaatat |
191 |
Q |
| |
|
|||||||||||||||| ||||| || ||||| |
|
|
| T |
21119909 |
aatgttaaaattcatgtaaattttataatat |
21119879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 73 - 157
Target Start/End: Original strand, 39120277 - 39120361
Alignment:
| Q |
73 |
atatggttcacagagatgcagaatcaaactcccaaccccgccaatattgtttggatggcaaaccgtgaaaaacctgtgaatggta |
157 |
Q |
| |
|
||||||||||| || ||||| ||| |||| ||||||||||| |||||||||||| ||||||||||| || ||||| ||||||| |
|
|
| T |
39120277 |
atatggttcactgaactgcagcctcacactcacaaccccgccactattgtttggatagcaaaccgtgacaaccctgtaaatggta |
39120361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 157
Target Start/End: Original strand, 39130010 - 39130094
Alignment:
| Q |
73 |
atatggttcacagagatgcagaatcaaactcccaaccccgccaatattgtttggatggcaaaccgtgaaaaacctgtgaatggta |
157 |
Q |
| |
|
||||||||||| || ||||| ||| |||| |||||| |||| ||||||||||| ||||||||||| || ||||| ||||||| |
|
|
| T |
39130010 |
atatggttcactgaactgcagcctcacactcacaaccctgccactattgtttggacagcaaaccgtgacaaccctgtaaatggta |
39130094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University