View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4590_low_10 (Length: 246)
Name: NF4590_low_10
Description: NF4590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4590_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 8797318 - 8797112
Alignment:
| Q |
18 |
gatgaaggaagtgaatatatagagatttgaagcgggaccatgtgggtttgtggggtcaaggtccatataagcccataaggaaggcagaggtttgcgtgtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
8797318 |
gatgaaggaagtgaatatatagagatttgaagcgggaccatgtgggtttgtgggttcaaggtccatata-gcccataaggaaggcagaggtttacgtgtc |
8797220 |
T |
|
| Q |
118 |
atgggaccacattagcaatgcacatgcaaacataaaccgcaatgtgaaaggtcggttgattgtctggttttttatgttatgattatgtgtacgttgttat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8797219 |
atgggaccacattagcaatgcacatgcaaacataaaccgcaatgtgaaaggtcggttgattgtctggttttttatgttatgattatgtgtacgttgttat |
8797120 |
T |
|
| Q |
218 |
atagatcg |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
8797119 |
atagatcg |
8797112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University