View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4590_low_14 (Length: 237)

Name: NF4590_low_14
Description: NF4590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4590_low_14
NF4590_low_14
[»] chr4 (1 HSPs)
chr4 (18-234)||(53955615-53955831)


Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 53955615 - 53955831
Alignment:
18 aaaacggtgtataaactcttaaaattttggtgtctataactcagctgatttaatgcatgatctccaagcaactgggcaaatttaattggaatgagaattg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53955615 aaaacggtgtataaactcttaaaattttggtgtctataactcagctgatttaatgcatgatctccaagcaactgggcaaatttaattggaatgagaattg 53955714  T
118 tcacttataatataaccaactactttgtccatatcaatagtcaatgtgatctccaacgtgaacaa-nnnnnnnnnnnncttacttgaaaggtagatcact 216  Q
    ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||             ||||||||||||||||||||||    
53955715 tcacttaaaatataacc-actactttgtccatatcaatagtcaatgtgatctccaacgtgaacaatttttttttttttcttacttgaaaggtagatcact 53955813  T
217 gattgttcaaatttaata 234  Q
    ||||||||||||||||||    
53955814 gattgttcaaatttaata 53955831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University