View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4590_low_15 (Length: 231)
Name: NF4590_low_15
Description: NF4590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4590_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 17 - 167
Target Start/End: Complemental strand, 8793781 - 8793630
Alignment:
| Q |
17 |
acatatactcctgtctttaaataattataaagtaattgatagagaaagagtataactgatnnnnnnn-tattgtatataaaaaatcatgttgagagatat |
115 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
8793781 |
acatatactcttgtcttttaataattataaagtaattgatagagaaagagtataactgataaaaaaaatattatatataaaaaatcatgttgagagatat |
8793682 |
T |
 |
| Q |
116 |
cgacctcttaaatgcatctcaatttatttagtactatgatgttaagaatgga |
167 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8793681 |
cgacctcttaaatgtatctcaatttatttagtactatgatgttaagagtgga |
8793630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University