View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4590_low_5 (Length: 357)
Name: NF4590_low_5
Description: NF4590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4590_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 14 - 350
Target Start/End: Complemental strand, 53956125 - 53955792
Alignment:
| Q |
14 |
gagctgtacaaaggttcagaaaccgaggatgatacatgttatctgattgttttggcaacaagaaaaggcactttcaagctagacatggtggatgatcttc |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53956125 |
gagctgtataaaggttcagaaaccgaggatgatacatgttatctgattgttttggcaacaagaaaaggcactttcaagctagacatggtggatgatcttc |
53956026 |
T |
 |
| Q |
114 |
gtcgttacaagacatgggccactaccatcaatcatatgctcaagatttctacttcttttgcaaaatatgagctccaattttactgaaataaccatgttat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53956025 |
gtcgttacaagacatgggccactaccatcaatcatatgctcaagatttctacttcttttgcaaaatatgagctccaattttactgaaataaccatgttat |
53955926 |
T |
 |
| Q |
214 |
tatgatcactagtac-ttataacttatgtattcatttgcatctttaatcttatatattttcaacaactcttattacatgatgtattattcctattatgta |
312 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||| || ||||||||||||||| || |
|
|
| T |
53955925 |
tatgatcactagtactttataacttatgtattcatttgcatctttaatcttatatatttgcaaaaactattattaaattatgtattattcctat----ta |
53955830 |
T |
 |
| Q |
313 |
ttacatttgctcaatcattaatctacctttcaagtaag |
350 |
Q |
| |
|
||| ||||| |||||| | |||||||||||||||||| |
|
|
| T |
53955829 |
ttaaatttgaacaatcagtgatctacctttcaagtaag |
53955792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University