View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4591_low_6 (Length: 350)
Name: NF4591_low_6
Description: NF4591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4591_low_6 |
 | |
|
| [»] scaffold0027 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0027 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 334
Target Start/End: Original strand, 17381 - 17712
Alignment:
| Q |
1 |
caaacaataaaggttgcacatggctgcataagctgaattttctttatcatatgatccccgatccctataaatgaatatgacatcacatgttaatgaatga |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17381 |
caaacaataaaggttgcacatggctacataagctaaattttctttatcatatgatccccgatccctataaatgaatatgacatcacatgttaatgaatga |
17480 |
T |
|
| Q |
101 |
gtatggtaccaatacaaaataaataaaaattatgtatcaaattaaacttgcttcctacgccctaatgattgaacagaataattgcttattgatgatccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17481 |
gtatggtaccaatacaaaataaataaaaattatgtatcaaattaaacttgcttcctacgccctaatgattgaacagaataattgcttattgatgatccat |
17580 |
T |
|
| Q |
201 |
aatccaccacactttctccatatgcacaacaattatactcctatcttaatgtgtgatgcatcatcatccagccc-ataatttatgcatcctacacataac |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17581 |
aatccaccacactttctccatatgcacaacaattatactcctatcttaacgtgtgatg---catcatccagcccaataatttatgcatcctacacataac |
17677 |
T |
|
| Q |
300 |
tgaaaactttagtactatatgaatatgacacattt |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
17678 |
tgaaaactttagtactatatgaatatgacacattt |
17712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University