View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4592_high_8 (Length: 236)
Name: NF4592_high_8
Description: NF4592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4592_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 151
Target Start/End: Complemental strand, 3048048 - 3047911
Alignment:
| Q |
14 |
cagtaatagcaacacaattttatggtttgaatcaatctgaaccattggattcatttacttcgtgaatgcgtccaaattagattattaagaatcctaacac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3048048 |
cagtaatagcaacacaattttatggtttgaatcaatctgaaccattggattcatttacttcgtgaatgcgtccaaattagattattaagaatcctaacac |
3047949 |
T |
|
| Q |
114 |
aagaaggacatactcaactcaagcaattatgctttgtc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3047948 |
aagaaggacatactcaactcaagcaattatgctttgtc |
3047911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University