View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4594_high_13 (Length: 238)
Name: NF4594_high_13
Description: NF4594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4594_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 10109069 - 10108848
Alignment:
| Q |
1 |
attatacttgtattcagatgcatgcaattggaagaatctatgagtccaggtaacaaaagtctaaaaacttaaataacacataaaatatttttgtcattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10109069 |
attatacttgtattcagatgcatgcaattggaagaatctatgagtccaggtaacaaaagtctaaaaacttaaataacaaataaaatatttttgtcattag |
10108970 |
T |
 |
| Q |
101 |
tacataattatctgtatatctattcaatcttatgtataatggttgtacnnnnnnnttatgcatgtaacgacagcaatacaatgtttgccaacaatatact |
200 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| ||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
10108969 |
tacattattatctgtatatctattctatcttatgcataatggttgtacaaaaaaattatgcatgtaatgacagcaatacaatgtttaccaacaatatact |
10108870 |
T |
 |
| Q |
201 |
ttgtcccttcttaagagtctag |
222 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
10108869 |
ttgtccctttttaagagtctag |
10108848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University