View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4594_high_16 (Length: 230)

Name: NF4594_high_16
Description: NF4594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4594_high_16
NF4594_high_16
[»] chr7 (1 HSPs)
chr7 (154-213)||(3182919-3182978)


Alignment Details
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 154 - 213
Target Start/End: Original strand, 3182919 - 3182978
Alignment:
154 ccatacaaattgatgttaaaataagaagctagtagaaaaggagggaatgcatgcactttg 213  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
3182919 ccatacaaattgatgttaaaataagaagctaatagaaaaggagggaatgcatgcactttg 3182978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University