View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4594_high_16 (Length: 230)
Name: NF4594_high_16
Description: NF4594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4594_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 154 - 213
Target Start/End: Original strand, 3182919 - 3182978
Alignment:
| Q |
154 |
ccatacaaattgatgttaaaataagaagctagtagaaaaggagggaatgcatgcactttg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3182919 |
ccatacaaattgatgttaaaataagaagctaatagaaaaggagggaatgcatgcactttg |
3182978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University