View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4594_high_18 (Length: 210)

Name: NF4594_high_18
Description: NF4594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4594_high_18
NF4594_high_18
[»] chr4 (1 HSPs)
chr4 (16-196)||(26452906-26453086)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 26453086 - 26452906
Alignment:
16 atgaacaagcttatacttagccctgcttctatcacagcctttgttcgaaagcagaaccgcggcaccaccaacgcgaaacaaacaattcggaatcaacata 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26453086 atgaacaagcttatacttagccctgcttctatcacagcctttgttcgaaagcagaaccgcggcaccaccaacgcgaaacaaacaattcggaatcaacata 26452987  T
116 gatttcttattaccaaaataccaattttgagtaatattctcagtactaacaacaacagcataagtatttctatgaacttga 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26452986 gatttcttattaccaaaataccaattttgagtaatattctcagtactaacaacaacagcataagtatttctatgaacttga 26452906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University