View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4594_low_13 (Length: 239)
Name: NF4594_low_13
Description: NF4594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4594_low_13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 21291859 - 21292075
Alignment:
| Q |
18 |
gctagcagcacctaattataaaaatagaatagaatataatttaattagtatgcatatgtgtataattttcatctggcggtgggttttatcaccgtcatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
21291859 |
gctagcagcacctaattataaaaatagaatagaatataatttaattagtatgcatatgtgtataattttcatctggcggtgggttttatcaccgtcgcga |
21291958 |
T |
|
| Q |
118 |
cgggtgctatggttggtgctcgcgttttgggcaaaattaaaattgtatgggttggtgtgatttgaatcagttctgcactttcgggttccgagcatgtggg |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21291959 |
cgggtgctatggttggtgctcgtgttttgggca-----aaaattgtacgggttggtgtgatttgaatcagttatgcactttcgggttccgagcatgtggg |
21292053 |
T |
|
| Q |
218 |
ttatatcggatggccgctccat |
239 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
21292054 |
ttatgtcggatggccgctccat |
21292075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 83 - 153
Target Start/End: Original strand, 11121034 - 11121104
Alignment:
| Q |
83 |
ttttcatctggcggtgggttttatcaccgtcatgacgggtgctatggttggtgctcgcgttttgggcaaaa |
153 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||| ||||||||||||||| |||||| |||||| |||| |
|
|
| T |
11121034 |
ttttcatccggcggtgggttttatcaccgccatgactggtgctatggttggttctcgcgctttgggaaaaa |
11121104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University