View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4594_low_15 (Length: 237)
Name: NF4594_low_15
Description: NF4594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4594_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 10108824 - 10108636
Alignment:
| Q |
1 |
taataaatattgttacttttgatacaattttccaattaaaaaggaacatatgaaatactcttcaaataaacatatgttttagaaaaataaaacatatact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
10108824 |
taataaatattgttacttttgatacaattttccaattaaaaaggaacatatgaaatactcttcaaataaacatatgttttcgaaaaataaaacacatact |
10108725 |
T |
 |
| Q |
101 |
tatagaagtggtgatatttgtggattgagttttggaaaacaaactagaagactcttacaatactgtgaatcaaaatttgaatcttaaac |
189 |
Q |
| |
|
| ||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
10108724 |
tctagaattggtgatatttgtggatcgagttttggaaaacaaactagaagactcttacgatgctatgaatcaaaatttgaatcttaaac |
10108636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University