View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4595-Insertion-12 (Length: 239)
Name: NF4595-Insertion-12
Description: NF4595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4595-Insertion-12 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 8 - 239
Target Start/End: Complemental strand, 42899568 - 42899337
Alignment:
| Q |
8 |
gtaagcaataaaatgttgtgaaatgaagtgcgtagtggagctctgctctggtgcgtcacaaatcgcgatggaattgtatcctcgtgcgagatacagaaag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42899568 |
gtaagcaataaaatgttgtgaaatgaagtgcgtagtggagctctgctctggtgcgtcacaaatcgcgatggaattgtatcctcgtgcgagatacagaaag |
42899469 |
T |
 |
| Q |
108 |
gaagatctgaagnnnnnnnnnnnnnnnnnnnnnnnttgaactcactgttaaccgcgcccgatgagcaagtccgtctgcgttttccgcccagttgtgatca |
207 |
Q |
| |
|
||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42899468 |
gaaaatctgaagaaaaaaaatagaaaaaggaaaaattgaactcactgttaaccgcgcccgatgagcaagtccgtctgcgttttccgcccagttgtgatca |
42899369 |
T |
 |
| Q |
208 |
gtgtttctattttgttttcgtggatggatgga |
239 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
42899368 |
gtgtttctatgttgttttcgtggatggatgga |
42899337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 210
Target Start/End: Original strand, 19386499 - 19386543
Alignment:
| Q |
166 |
cgatgagcaagtccgtctgcgttttccgcccagttgtgatcagtg |
210 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||| |||||||| |
|
|
| T |
19386499 |
cgatgagcaagttcgtctgcgttttccgggcagttgagatcagtg |
19386543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University