View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4595-Insertion-13 (Length: 180)
Name: NF4595-Insertion-13
Description: NF4595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4595-Insertion-13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 8e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 8e-35
Query Start/End: Original strand, 102 - 180
Target Start/End: Original strand, 17859508 - 17859586
Alignment:
| Q |
102 |
cactaacactagttttttcaatcacagctcattggttgtgattgagatgatgatgcatctccttgtacaacagctgctc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17859508 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgctc |
17859586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 75; Significance: 8e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 8e-35
Query Start/End: Original strand, 102 - 180
Target Start/End: Original strand, 4968039 - 4968117
Alignment:
| Q |
102 |
cactaacactagttttttcaatcacagctcattggttgtgattgagatgatgatgcatctccttgtacaacagctgctc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4968039 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgctc |
4968117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 102 - 180
Target Start/End: Complemental strand, 34916304 - 34916226
Alignment:
| Q |
102 |
cactaacactagttttttcaatcacagctcattggttgtgattgagatgatgatgcatctccttgtacaacagctgctc |
180 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34916304 |
cactaacattagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgctc |
34916226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University