View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4595_low_13 (Length: 242)
Name: NF4595_low_13
Description: NF4595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4595_low_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 34651780 - 34651560
Alignment:
| Q |
18 |
ttcaaaagacaagcatgtaactgcttcacacgtaatagggacttacaaacgttggtgagttcagaatggagccagtgaaactgaatcaacattaattatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
34651780 |
ttcaaaagacaagcatgtaactgcttcacacgtaatagggacttacaaacgttggtgagttcagaatggagccagtgaaactgagtcagcattaattatt |
34651681 |
T |
 |
| Q |
118 |
atggtaacaacgtaaactctgtgtgtgatttatgtgatagtgaaaacaacaacatgaacaatcacaatataggtttggttaaatggaatggagggaaggg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34651680 |
atggtaacaacgtaaactctgtgtgtgatttatgtgatagtgaaaacaacaacatgaacaatcacaatataggtttgg----atggaatggagggaaggg |
34651585 |
T |
 |
| Q |
218 |
ggagggagaaatgttaaaatattgt |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34651584 |
ggagggagaaatgttaaaatattgt |
34651560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University