View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4596_low_2 (Length: 446)
Name: NF4596_low_2
Description: NF4596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4596_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 75 - 405
Target Start/End: Original strand, 21191674 - 21192004
Alignment:
| Q |
75 |
actaatttagatcttccactttgattttgtagactagtttagatcttctcacaaagatttctcctagcaacaaactggatgatagagaatattccaatgc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21191674 |
actaatttagatcttccactttgattttgtagactagtttagatcttctcacaaagatttctcctagcaacaaactggatgatagagaatattccaatgc |
21191773 |
T |
 |
| Q |
175 |
aaggaacgaaaatgaggtgtgtttttcttggtattcatctatagatattgttttgattttatgaagaaatatgtatatacatgttaagaatggtttttat |
274 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21191774 |
aaggaacgaaaatgaggtatgtttttcttggtgttcatctatagatattgttttgattttttgaagaaatatgaatatacatgttaagaatggtttttat |
21191873 |
T |
 |
| Q |
275 |
tttgtttcacattatcacaacatacatctttctatattttttctatcatccatcacatgatcattcttcttttgcattgagctttacaatctcatattgg |
374 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21191874 |
tttctttcacattatcacaacatacatctttctatattttttctatcatccatcacatgatcattcttcttttgcattgagctttacaatctcatattgg |
21191973 |
T |
 |
| Q |
375 |
attgcatatgtgatatgagttctacaccatg |
405 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
21191974 |
attgtatatgtgatatgagttctacaccatg |
21192004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University