View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4597-Insertion-11 (Length: 202)
Name: NF4597-Insertion-11
Description: NF4597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4597-Insertion-11 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 10 - 202
Target Start/End: Original strand, 192787 - 192982
Alignment:
| Q |
10 |
taatacatttatctcaagatattgtcaatttcaggttcaaatgaattctcttgcaaacctgca---tgattcaataaaaacatgaattttcagaaacaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||| |
|
|
| T |
192787 |
taatacatttatctcaagatattgtcaatttcaggttcaaatgaattctcttgcaaacctgcaaaatgattcaataaaaacatgaatattgagaaacaaa |
192886 |
T |
 |
| Q |
107 |
aagaatttaaaatatatttggttacacaatattgtttagcagaatatgaattacttgagcatgatattgcttcggtgagctttctttgcggttcag |
202 |
Q |
| |
|
| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
192887 |
acgaatttaaaatatctttggtcacacaatattgtttagcagaatatgaattacttgagcatgatattgcttcggtgagctttctttgcagttcag |
192982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University