View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4597-Insertion-12 (Length: 109)
Name: NF4597-Insertion-12
Description: NF4597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4597-Insertion-12 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 5e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 5e-41
Query Start/End: Original strand, 7 - 109
Target Start/End: Original strand, 6015080 - 6015184
Alignment:
| Q |
7 |
agatctaacttccactcctccactattgttactcccaacgct-cccagactcccgaaaggtt-aaaaaatcaatgattaaagaatctactatgtagtata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6015080 |
agatctaacttccactcctccactattgttactcccaacgctccccagactctcgaaaggttaaaaaaatcaatgattaaagaatctactatgtagtata |
6015179 |
T |
|
| Q |
105 |
tggca |
109 |
Q |
| |
|
||||| |
|
|
| T |
6015180 |
tggca |
6015184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University