View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4597-Insertion-14 (Length: 53)

Name: NF4597-Insertion-14
Description: NF4597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4597-Insertion-14
NF4597-Insertion-14
[»] chr3 (2 HSPs)
chr3 (8-45)||(17663366-17663403)
chr3 (8-45)||(19246021-19246058)


Alignment Details
Target: chr3 (Bit Score: 38; Significance: 0.0000000000002; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 17663366 - 17663403
Alignment:
8 aaggttgcttgaagaattgcctgaagggtgcatcgcga 45  Q
    ||||||||||||||||||||||||||||||||||||||    
17663366 aaggttgcttgaagaattgcctgaagggtgcatcgcga 17663403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 19246021 - 19246058
Alignment:
8 aaggttgcttgaagaattgcctgaagggtgcatcgcga 45  Q
    ||||||||||||||||||||||||||||||||||||||    
19246021 aaggttgcttgaagaattgcctgaagggtgcatcgcga 19246058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University