View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4597_high_3 (Length: 432)
Name: NF4597_high_3
Description: NF4597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4597_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 19 - 417
Target Start/End: Complemental strand, 45127332 - 45126934
Alignment:
| Q |
19 |
ttattatacatcatgacactgacactaccatctttcaatacccttcttctcatcttattcattccttgctatctgtctctacctatcactatccctatcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45127332 |
ttattatacatcatgacactgacactaccatctttcaatacccttcttctcatcttattcattccttgctatctgtctctacctatccctatccctatcc |
45127233 |
T |
 |
| Q |
119 |
ctgatgcagcaacagttcaaccactcacaccaaatccatcttcatcttcaaaaggaacaatccctgcctttcctgaacaagctgatgttgcaagatgccc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127232 |
ctgatgcagcaacagttcaaccactcacaccaaatccatcttcatctttacaaggaacaatccctgcctttcctgaacaagctgatgttgcaagatgccc |
45127133 |
T |
 |
| Q |
219 |
tttaagtctctcagatgaacacttgaatggaataaaaaacgcatgcagttccaaatccaacaaacatgatgctgctgatgatgaacttcaccgtagccga |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45127132 |
tttaagtctctcagatgaacacttgaatggaatcaaaaacgcatgcagttccaaatccaacaaacatgatgctgctgatgatgaacttcaccgtagccga |
45127033 |
T |
 |
| Q |
319 |
tgttgtcctgctctagctgcgtggctatattctgcttactctgccactgctcttggtggatttgaacatggacacactacatcctatgacatgcctttg |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45127032 |
tgttgtcctgctctagctgcgtggctatattctgcttactctgccactgctcttggtggatttgaacatggacacactacatcatatgacatgcctttg |
45126934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University