View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4597_low_14 (Length: 250)
Name: NF4597_low_14
Description: NF4597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4597_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 10386870 - 10387105
Alignment:
| Q |
1 |
agtaaatgacatataaaaatatttctttacgaattgatatgaattgaatctagttttttaataaaaatagaaaatttggatttgatttatatatactttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10386870 |
agtaaatgacatataaaaatatttctttacgaattgatatgaattaaatctagttttttaataaaaatagaaaatttggatttgatttatatatactttt |
10386969 |
T |
 |
| Q |
101 |
agtgtaaagaattttacaatgtcaatcaattataccatgattaagaataattgata-tttttaataaaataatatagtggtgagattcatacacttgaag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||| ||||||||||||||| |||||||||| |
|
|
| T |
10386970 |
agtgtaaagaattttacaatgtcaatcaattataccatgattaagaataattgatattttttaatcacataatctagtggtgagattcacacacttgaag |
10387069 |
T |
 |
| Q |
200 |
ggtagagaagtagaaaattcagagtttgaacccttc |
235 |
Q |
| |
|
||| |||| ||||||||||| ||||| |||||||| |
|
|
| T |
10387070 |
tgtacagaaatagaaaattcaaagtttaaacccttc |
10387105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University