View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4597_low_8 (Length: 305)
Name: NF4597_low_8
Description: NF4597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4597_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 51964806 - 51964521
Alignment:
| Q |
1 |
gggtttaaagtcgaggttgtaggctgttgataaatacaaaggccaactgattgtaagattgaaagcgtttcatggtccgtctcaatcagcaagcttagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51964806 |
gggtttaaagtcgaggttgtaggctgttgataaatacaaaggccaactgattgtaagattgaaagcgtttcatggtccgtctcaatcagcaagcttagct |
51964707 |
T |
|
| Q |
101 |
tcctctgtttgacaacaaattttcagctactttgtgcaaaataaataagagaggggggaaatttaattaaggtagtttgcatcaaaacaggatcttaagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51964706 |
tcctctgtttgacaacaaattttcagctactttgtgcaaaataaataagagagaggggaaatttaattaaggtagtttgcatcaaaacaggatcttaagt |
51964607 |
T |
|
| Q |
201 |
agagagcacagttgtggagcccaataagtgtctcagttgtctaatccatcaccatctaggcatttgtgattcttggcagaccttgt |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
51964606 |
agagagcacagttgtggagcccaataagtgtcccagttgtctaatccatcactatctaggcctttgtgattcttggcagaccttgt |
51964521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University