View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4597_low_9 (Length: 293)
Name: NF4597_low_9
Description: NF4597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4597_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 77 - 277
Target Start/End: Complemental strand, 32482755 - 32482555
Alignment:
| Q |
77 |
ccataattctaaattacctctgtaagatgaaacatcatcgtttttgttgtaccaaaatagtgtctcttgtggtggaatatgaccttgttgttgtgattct |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482755 |
ccataattctaaattacctctgtaagatgaaacatcatcgtttttgttgtaccaaaatagtgtctcttgtggtggaatatgaccttgttgttgtgattct |
32482656 |
T |
|
| Q |
177 |
tctccttggtttcctcttccacctccacctaatgagaacaaaccagccatttctttgaagnnnnnnnccttaaccctaacaacaatagtttctttaattg |
276 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
32482655 |
tctccttggtttcctcttccacctcctcctaatgagaacaaaccagccatttctttgaagaaaaaaaccttaaccctaacaacaatactttctttaattg |
32482556 |
T |
|
| Q |
277 |
t |
277 |
Q |
| |
|
| |
|
|
| T |
32482555 |
t |
32482555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 40
Target Start/End: Complemental strand, 32482821 - 32482792
Alignment:
| Q |
11 |
gaagaacggccgtgcagcatgcatatcatc |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32482821 |
gaagaacggccgtgcagcatgcatatcatc |
32482792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University