View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4598-Insertion-9 (Length: 257)
Name: NF4598-Insertion-9
Description: NF4598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4598-Insertion-9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 8 - 222
Target Start/End: Complemental strand, 13212082 - 13211868
Alignment:
| Q |
8 |
cttataacttagtttaaattgaagacttttctttgatcatggtattaagttgactacttgatgatgttgaattgaaagaaggatgtataaattcatgaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212082 |
cttataacttagtttaaattgaagacttttctttgatcatggtattaagttgactacttgatgatgttgaattgaaagaaggatgtataaattcatgaat |
13211983 |
T |
 |
| Q |
108 |
tttttgtggggtttgaattttatgatattgcatccaaaacagttaaattaattttcttgttcagctaaaaatgttcttagttgcttccaaatgaagcagc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13211982 |
tttttgtggggtttgaattttatgatattgcatccaaaacagttaaattaattttcttgttcagctaaaaatgttcttagttgcttccaaatgaagcagc |
13211883 |
T |
 |
| Q |
208 |
agaaggtagcatgtg |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13211882 |
agaaggtagcatgtg |
13211868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University