View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4598_high_6 (Length: 252)

Name: NF4598_high_6
Description: NF4598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4598_high_6
NF4598_high_6
[»] chr4 (2 HSPs)
chr4 (155-242)||(18780258-18780345)
chr4 (1-52)||(18780106-18780157)


Alignment Details
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 155 - 242
Target Start/End: Original strand, 18780258 - 18780345
Alignment:
155 gttatcacagaaattgtcttaattgatttttcaaacatcactactctaatttcatttttcaaattgtttagattaaaaataccctttg 242  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18780258 gttatcacaaaaattgtcttaattgatttttcaaacatcactactctaatttcatttttcaaattgtttagattaaaaataccctttg 18780345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 18780106 - 18780157
Alignment:
1 tgcttgtaataattttattataaatgatatttgtataaccacattataacaa 52  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||    
18780106 tgcttgtaataattttattataaatgatatttgtataaccactttataacaa 18780157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University