View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4598_high_6 (Length: 252)
Name: NF4598_high_6
Description: NF4598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4598_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 155 - 242
Target Start/End: Original strand, 18780258 - 18780345
Alignment:
| Q |
155 |
gttatcacagaaattgtcttaattgatttttcaaacatcactactctaatttcatttttcaaattgtttagattaaaaataccctttg |
242 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18780258 |
gttatcacaaaaattgtcttaattgatttttcaaacatcactactctaatttcatttttcaaattgtttagattaaaaataccctttg |
18780345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 18780106 - 18780157
Alignment:
| Q |
1 |
tgcttgtaataattttattataaatgatatttgtataaccacattataacaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18780106 |
tgcttgtaataattttattataaatgatatttgtataaccactttataacaa |
18780157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University