View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4598_low_9 (Length: 240)
Name: NF4598_low_9
Description: NF4598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4598_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 10 - 222
Target Start/End: Original strand, 40708510 - 40708722
Alignment:
| Q |
10 |
ggagcagagatggtgggatttttagaagttatgaaggttttaggttctatctgagtttcttggtttggttttccaattttggttgatgttgagtttcaat |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708510 |
ggagaagagatggtgggatttttagaagttatgaaggttttaggttctatctgagtttcttggtttggttttccaattttggttgatgttgagtttcaat |
40708609 |
T |
|
| Q |
110 |
caattttccatattgggagctaatatgtgatacagtttcaggtaagttttctagcaatttccttagttatagccaatttgatttannnnnnnnagaaaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40708610 |
caattttccatattgggagctaatatgtgatacagtttcaggtaagttttctagcaatttccttagttatagccaatttgattttttttttttagaaaaa |
40708709 |
T |
|
| Q |
210 |
atagagatgaaga |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40708710 |
atagagatgaaga |
40708722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University