View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4599-Insertion-4 (Length: 429)
Name: NF4599-Insertion-4
Description: NF4599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4599-Insertion-4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 393; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 393; E-Value: 0
Query Start/End: Original strand, 9 - 429
Target Start/End: Original strand, 15689673 - 15690093
Alignment:
| Q |
9 |
atgcacaatcagtggttctgcgtttaagcaatctcagatgtttcgatcccggtgggttgttatcccgcgagcttgacgcaactcatctttcacgctacag |
108 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15689673 |
atgcacaatcagtcgttctgcgtttaagcaatctcagatgttttgatcccggtgggttgttatcccgcgagcttgacgcaactcatctttcacgctacag |
15689772 |
T |
 |
| Q |
109 |
gttcacaccgattgttttggcagccaggatgccatcaccgtcaccaaggttctatccgcctccaaaaccacctgatacggttgttgagctctttcttacg |
208 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15689773 |
gttcacaccgattgttttggtagccacgatgccatcaccgtcaccaaggttctatccgcctccaaaaccacctgatacggttgttgagctctttcttacg |
15689872 |
T |
 |
| Q |
209 |
atcagaactaagtgctttggtccttctccacaagttcgtagcagatgcagaacaactcaaagtgctaaggtatttctgcatcaataggatttatttccac |
308 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15689873 |
atcagaactaagtgctctggtccttctccacaagttcgtagcaggtgcagaacaactcaaagtgctaaggtatttctgcatcaataggatttatttccac |
15689972 |
T |
 |
| Q |
309 |
atcttctaatctagttagaagtaactttgtaagtggtattccattgacaaggttagctggagataaatgtgcatcatagttatgtgacttttttgtgccc |
408 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15689973 |
atcttctaatctagttagaagtaactttgtaagtggtattccattgacaaggttagctggagataaatgtgcatcatagttatgtgactcttttgtgccc |
15690072 |
T |
 |
| Q |
409 |
ccctcaagatttggataacta |
429 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
15690073 |
ccctcaagatttggataacta |
15690093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University