View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4599-Insertion-7 (Length: 253)
Name: NF4599-Insertion-7
Description: NF4599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4599-Insertion-7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 243
Target Start/End: Original strand, 9613918 - 9614146
Alignment:
| Q |
15 |
cattaaaaccgaacggagcactttcaattgagaaaggattcttgagcctagcttcttgaaccaagcgggtgatgcgttcctcatcactttcagtagcaca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
9613918 |
cattaaaaccgaacggagcactttcaattgagagaggattcttgagcctagcttcttgaaccaatcgggcgatgcgttcctcatcactttcagtagcaca |
9614017 |
T |
|
| Q |
115 |
aatactatacgaaccatgagtagcaagctgcggaactggagtagcgttacgagtagttggaacctcttgaggctcactttcttctaataagcaccttgtt |
214 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9614018 |
aatactatgcggaccatgagtagcaagctgcggaactggagtagcattacgagtagttggaacctcttgaggctcactttcttccaataagcaccttgtt |
9614117 |
T |
|
| Q |
215 |
ggatcaaaagacacccaagtaccattcac |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9614118 |
ggatcaaaagacacccaagtaccattcac |
9614146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 14 - 99
Target Start/End: Original strand, 3966679 - 3966764
Alignment:
| Q |
14 |
acattaaaaccgaacggagcactttcaattgagaaaggattcttgagcctagcttcttgaaccaagcgggtgatgcgttcctcatc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
3966679 |
acattaaaaccgaacggagcactttcaattgagagaggattcttgagcctagcttcttgaaccaatcgggcgatgcgttcctcatc |
3966764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University