View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4599-Insertion-9 (Length: 130)
Name: NF4599-Insertion-9
Description: NF4599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4599-Insertion-9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 6e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 6e-41
Query Start/End: Original strand, 34 - 130
Target Start/End: Original strand, 39935881 - 39935977
Alignment:
| Q |
34 |
gttaacctttacttccttctcatgctgctttcaacttttctatcttttgtttccccacaacctcttgtctcaagggttggcacgttcttgtaaatta |
130 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39935881 |
gttaaccgttacttccttttcatgctgctttcaacttttctatcttttatttccccacaacctcttgtctcaagggttggcacgttcttgtaaatta |
39935977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University