View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4599_high_5 (Length: 300)
Name: NF4599_high_5
Description: NF4599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4599_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 291
Target Start/End: Original strand, 40540614 - 40540891
Alignment:
| Q |
18 |
gtactattattgttgtttggctgctatacaaaaataaccctgccataggtaaattgttttgttttacttttaccccaacattcctgttaagaaaagaata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40540614 |
gtactattattgttgtttggctgctatacaaaaataaccctgccataggtaaattgttttgttttacttttaccccaacattcctgttaagaaaagaata |
40540713 |
T |
|
| Q |
118 |
cattttttgactgatcttgactctagaaagccttgttatcnnnnnnnnnnnnnnnnnngtggtcttatacggaagagaagtggggatagatttcgata-- |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40540714 |
cattttttgactgatcttgactctagaaagccttgttatcttttttttctttctttttgtggtcttatacggaagagaagtggggatagatttcgataaa |
40540813 |
T |
|
| Q |
216 |
--aaaaagaaactctttaactttctcttttacatttcttcttgcagaagcttcattattgggtggaaagcagaataat |
291 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40540814 |
ataaaataaaactctttaactttctcttttacatttcttcttgcggaagcttcattattgggtggaaagcagaataat |
40540891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University