View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4600-Insertion-12 (Length: 113)
Name: NF4600-Insertion-12
Description: NF4600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4600-Insertion-12 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 9e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 9e-49
Query Start/End: Original strand, 8 - 113
Target Start/End: Original strand, 3331170 - 3331275
Alignment:
| Q |
8 |
tgattatggctgatcatgcagatcaaatgcccatacgtatgatcaagaaataattaacatgcaaaaatgagttttcaaacacttcgtcaagtgaatgcat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3331170 |
tgattatggctgatcatgcagatcaaatgcccatacatatgatcaagaaataattaacatgcaaaaatgagttttcaaacacttcatcaagtgaatgcat |
3331269 |
T |
 |
| Q |
108 |
gaaggc |
113 |
Q |
| |
|
|||||| |
|
|
| T |
3331270 |
gaaggc |
3331275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University