View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4600_high_13 (Length: 234)
Name: NF4600_high_13
Description: NF4600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4600_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 51767317 - 51767096
Alignment:
| Q |
1 |
ccatttctagcttcttccaaacacaatttcacgttcaataactgtatccttattaccatagccctgtcagaaagctaactttatgatacataacttgtat |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51767317 |
ccatttctagcttctgccaaacacaatttcacgttcaataactgtatccttattaccatagccctgtcagaaagctaactttatgatacataacttgtat |
51767218 |
T |
 |
| Q |
101 |
gcatggcctccctctaaaaacatggtccatttggaaaatacaatagtcaatgtagaatgatgtggatgcacatggaaatgattttgtgattcccttctcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51767217 |
gcatggcctccctctaaaaacatggtccatttggaaaatacaatagtcaatgtagaatgatgtggatgcacatggaaatgattttgtgattcccttctcc |
51767118 |
T |
 |
| Q |
201 |
aagaacatgggtgctccatctc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
51767117 |
aagaacatgggtgctccatctc |
51767096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 51755571 - 51755530
Alignment:
| Q |
1 |
ccatttctagcttcttccaaacacaatttcacgttcaataac |
42 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
51755571 |
ccatttctagtttctgccaaacacaatttcacgttccataac |
51755530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 143
Target Start/End: Complemental strand, 51755455 - 51755411
Alignment:
| Q |
99 |
atgcatggcctccctctaaaaacatggtccatttggaaaatacaa |
143 |
Q |
| |
|
||||| ||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
51755455 |
atgcaaggcctccctttgaaaacaaggtccatttggaaaatacaa |
51755411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University