View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4600_low_6 (Length: 314)
Name: NF4600_low_6
Description: NF4600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4600_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 307
Target Start/End: Original strand, 10251420 - 10251715
Alignment:
| Q |
18 |
gaaacaaaaacacttctcatattaggtgtgttccgatgtcgaacatgtgttagtgtcaatgcccgaatttggaaactaaaattccaaacctgaaatgtaa |
117 |
Q |
| |
|
|||||||||||| |||| |||||| | ||||||| ||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
10251420 |
gaaacaaaaacatttcttatattaagcgtgttccaatgtcaaacatgtgtcagtgtcaatgtccgaatttggaaactaaaattccaaacctgatatctaa |
10251519 |
T |
 |
| Q |
118 |
acgttctaatcttgatctaaccaacaaccaaagatattaatgcaatcatccgaattcctcttaggttatatatgccaactagtcgatg------tgtttc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10251520 |
acgttctaatcttgatctaaccaacaaccgaagatattaatgaaatcatccgaattcctcttaggttatatatgccaactagtcgatgctcccatgtttc |
10251619 |
T |
 |
| Q |
212 |
taatattctggcaggttgatttggttagcaacataggtttggttggtcatgtttcgtttggcgatgttctattgcctctaatttattcctatgcta |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10251620 |
taatattctggcaggttgatttggttagcaacataggtttggttggtcatgtttcgtttggcgatgttctattgcctctaatttattcctatgcta |
10251715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University